- Clone
- A18042B (See other available formats)
- Regulatory Status
- RUO
- Other Names
- OX-2, OX2
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AGTCCTCAGTATCCT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
| Cat # | Size | Price | Quantity Check Availability | Save | ||
|---|---|---|---|---|---|---|
| 399809 | 10 µg | 296€ | ||||
CD200, also known as OX2, is a member of the immunoglobulin superfamily (IgSF). It is a monomorphic cell surface glycoprotein expressed on thymocytes, neurons, endothelium, follicular dendritic cells within lymphoid organs, and a subset of CD34⁺ progenitor cells. CD200 is also expressed at low levels on certain smooth muscle cells and B lymphocytes, but is not detected on NK cells, monocytes, granulocytes, or platelets. CD200 co-stimulates T cell proliferation and is implicated in the regulation of myeloid cell activity in a variety tissues. The interaction between CD200 (OX2) and its receptor, CD200R (OX2R), plays an important role in modulating macrophage and granulocyte activation, which may contribute to pathways that suppress and limit macrophage-induced inflammatory damage in tissues.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Recombinant human CD200
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone A18042B antibody is able to completely block the staining of OX-104 antibody, but OX-104 antibody does not completely block the staining of A18042B antibody.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2936583 (BioLegend Cat. No. 399809)
Antigen Details
- Structure
- Ig superfamily, 80 kD
- Distribution
-
T cells, neurons, endothelium
- Function
- Costimulates T cell proliferation
- Ligand/Receptor
- CD200R
- Cell Type
- Endothelial cells, Neurons, T cells
- Biology Area
- Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
- Molecular Family
- CD Molecules
- Antigen References
-
- Wright GJ, et al. 2001. Immunology. 102:173.
- Foster-Cuevas M, et al. 2004. J. Virol. 78:7667.
- Mason D, et al. 2002. ed. Leukocyte Typing VII. New York:Oxford Univ. Press.
- Broderick C, et al. 2002. Am. J. Pathol. 161:1669.
- Gene ID
- 4345 View all products for this Gene ID
- UniProt
- View information about CD200 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD200 Reagents Request Custom Conjugation| Description | Clone | Applications |
|---|---|---|
| PE anti-human CD200 (OX2) | A18042B | FC |
| Purified anti-human CD200 (OX2) | A18042B | FC |
| PE/Cyanine7 anti-human CD200 (OX2) Antibody | A18042B | FC |
| APC anti-human CD200 (OX2) | A18042B | FC |
| TotalSeq™-D1278 anti-human CD200 (OX2) | A18042B | PG |
| PE/Cyanine7 anti-human CD200 | A18042B | FC |
| PE anti-human CD200 | A18042B | FC |
| APC anti-human CD200 | A18042B | FC |
| PE/Fire™ 700 anti-human CD200 (OX2) | A18042B | FC |
| GMP PE anti-human CD200 | A18042B | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE anti-human CD200 (OX2)
Human peripheral blood lymphocytes were stained with APC CD4... -
Purified anti-human CD200 (OX2)
Human peripheral blood lymphocytes were stained with purifie... -
PE/Cyanine7 anti-human CD200 (OX2) Antibody
Human peripheral blood lymphocytes were stained with CD4 APC... -
APC anti-human CD200 (OX2)
Human peripheral blood lymphocytes were stained with anti-hu... -
TotalSeq™-D1278 anti-human CD200 (OX2)
-
PE/Cyanine7 anti-human CD200
Typical results from human peripheral blood lymphocytes stai... -
PE anti-human CD200
Typical results from human peripheral blood lymphocytes stai... -
APC anti-human CD200
Typical results from human peripheral blood lymphocytes stai... -
PE/Fire™ 700 anti-human CD200 (OX2)
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP PE anti-human CD200
Typical results from human peripheral blood lymphocytes stai...
Login / Register 


Follow Us