- Clone
- BV9 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- VE-Cadherin, cadherin-5, CDH5
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- TCCACTCATTCTGTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
| Cat # | Size | Price | Quantity Check Availability | Save | ||
|---|---|---|---|---|---|---|
| 348525 | 10 µg | £253 | ||||
CD144, also known as VE-cadherin and cadherin-5, is a 140 kD glycoprotein which is composed of five extracellular cadherin repeats and a highly conserved cytoplasmic tail region. It is a calcium-dependent transmembrane cell-cell adhesion molecule localized at the intercellular boundaries of endothelial cells, hematopoietic stem cells, and perineurial cells. It functions as a classic cadherin by mediating homophilic adhesion and functions as a plasma membrane attachment site for the cytoskeleton. CD144 is thought to play a role in vascular development, permeability, and remodeling.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone BV9 has been shown to block VE-cadherin, causing a redistribution of VE-cadherin away from intracellular junctions.6 This clone binds to EC3-EC4 region in the extracellular domain of human VE-cadherin.7 Additional reported applications (for the relevant formats) include: Western Blotting1,2, immunofluorescence microscopy1,3, immunoprecipitation1,4, blocking angiogenesis in vitro4,5, inhibiting VE-cadherin reorganization4, and inducing endothelial cell apoptosis4.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Almagro S, et al. 2010. Mol. Cell Biol. 30:1703. (WB, IF, IP)
- Zhang F, et al. 2004. J. Biol. Chem. 279:11760. (WB)
- Iurlaro M, et al. 2004. Am. J. Pathol. 165:181. (IF)
- Corada M, et al. 2001. Blood 97:1679. (IP, Block)
- Kooistra M, et al. 2005. FEBS 579:4966. (Block)
- Corada M, et al. 2001. Blood 97:1679. (Block)
- Bouillet L, et al. 2013. Laboratory Investigation 93:1194-11202.
- RRID
-
AB_3675069 (BioLegend Cat. No. 348525)
Antigen Details
- Structure
- Member of the cadherin family; calcium-dependent transmembrane cell-cell adhesion glycoprotein composed of five extracellular cadherin repeats and a highly conserved cytoplasmic tail region
- Distribution
-
Endothelial cells, hematopoietic stem cells, perineurial cells
- Function
- Mediates calcium-dependent homophilic cell adhesion, plays fundamental roles in microvascular permeability and in the morphogenic and proliferative events associated with angiogenesis
- Ligand/Receptor
- VE-cadherin
- Cell Type
- Endothelial cells, Hematopoietic stem and progenitors, Mesenchymal Stem Cells
- Biology Area
- Angiogenesis, Cell Adhesion, Cell Biology, Cell Motility/Cytoskeleton/Structure, Immunology, Stem Cells
- Molecular Family
- Adhesion Molecules, CD Molecules, Protein Kinases/Phosphatase
- Antigen References
-
1. Taddei A, et al. 2008. Nat. Cell Biol. 10:923.
2. Gavard J, et al. 2006. Nat. Cell Biol. 8:1223.
3. Kim I, et al. 2005. Blood 106:903.
4. Suzuki S, et al. 1991. Cell Regul. 2:261. - Gene ID
- 1003 View all products for this Gene ID
- UniProt
- View information about CD144 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD144 Reagents Request Custom Conjugation| Description | Clone | Applications |
|---|---|---|
| Purified anti-human CD144 (VE-Cadherin) | BV9 | FC,ICC,WB,IP |
| PE anti-human CD144 (VE-Cadherin) | BV9 | FC |
| APC anti-human CD144 (VE-Cadherin) | BV9 | FC |
| PerCP/Cyanine5.5 anti-human CD144 (VE-Cadherin) | BV9 | FC |
| Alexa Fluor® 594 anti-human CD144 (VE-Cadherin) | BV9 | ICC,IHC-P |
| Alexa Fluor® 647 anti-human CD144 (VE-Cadherin) | BV9 | FC,IHC-P |
| PE/Cyanine7 anti-human CD144 (VE-Cadherin) | BV9 | FC |
| PE/Dazzle™ 594 anti-human CD144 (VE-Cadherin) | BV9 | FC |
| TotalSeq™-A0400 anti-human CD144 (VE-Cadherin) | BV9 | PG |
| TotalSeq™-C0400 anti-human CD144 (VE-Cadherin) | BV9 | PG |
| TotalSeq™-B0400 anti-human CD144 (VE-Cadherin) | BV9 | PG |
| TotalSeq™-D0400 anti-human CD144 (VE-Cadherin) | BV9 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD144 (VE-Cadherin)
Human umbilical vein endothelial cells, HUVEC, stained with ...
HUVEC cells were fixed with 1% paraformaldehyde (PFA) and th... -
PE anti-human CD144 (VE-Cadherin)
Human umbilical vein endothelial cells, HUVEC, stained with ... -
APC anti-human CD144 (VE-Cadherin)
Human umbilical vein endothelial cells, HUVEC, stained with ... -
PerCP/Cyanine5.5 anti-human CD144 (VE-Cadherin)
Human umbilical vein endothelial cells (HUVEC) were stained ... -
Alexa Fluor® 594 anti-human CD144 (VE-Cadherin)
Human umbilical vein endothelial cells (HUVEC) were fixed wi...
Human paraffin-embedded placenta tissue slices were prepared... -
Alexa Fluor® 647 anti-human CD144 (VE-Cadherin)
Human umbilical vein endothelial cells (HUVEC) were stained ...
Human paraffin-embedded colorectal cancer tissue slices were... -
PE/Cyanine7 anti-human CD144 (VE-Cadherin)
Human umbilical vein endothelial cells (HUVEC) were stained ... -
PE/Dazzle™ 594 anti-human CD144 (VE-Cadherin)
Human umbilical vein endothelial cells (HUVEC) were stained ... -
TotalSeq™-A0400 anti-human CD144 (VE-Cadherin)
-
TotalSeq™-C0400 anti-human CD144 (VE-Cadherin)
-
TotalSeq™-B0400 anti-human CD144 (VE-Cadherin)
-
TotalSeq™-D0400 anti-human CD144 (VE-Cadherin)
Login / Register 



Follow Us