- Clone
- S16017E (See other available formats)
- Regulatory Status
- RUO
- Other Names
- TPOR, c-MPL, MPLV
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- TGTTGTAAGATGCCA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
| Cat # | Size | Price | Quantity Check Availability | Save | ||
|---|---|---|---|---|---|---|
| 393721 | 10 µg | 296€ | ||||
CD110 is a type I transmembrane glycoprotein which functions as a receptor for thrombopoietin; binding causes the proliferation and differentiation of megakaroyocytes in addition to the production of platelets and protection of stem cells from apoptosis. CD110 is primarily expressed on hematopoietic stem cells, hematopoietic precursor cells, cells of the megakaryocytic lineage, and platelets.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human CD110 transfectants
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_3717212 (BioLegend Cat. No. 393721)
Antigen Details
- Structure
- Type I transmembrane glycoprotein
- Distribution
-
Hematopoietic stem cells, a subfraction of hematopoietic precursor cells, cells of the megakaryocytic lineage, and platelets.
- Function
- Megakaryocytopoiesis and platelet formation
- Interaction
- THPO, ATXN2L, JAK2
- Ligand/Receptor
- Thrombopoietin
- Cell Type
- Hematopoietic stem and progenitors, Megakaryocytes, Platelets
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
- Ninos JM, et al. 2006. J. Transl. Med. 16:4-9.
- Broudy VC, et al. 1996. Blood. 88:2026-32.
- Wang X, et al. 2016. Blood. 127:3398-409.
- Gene ID
- 4352 View all products for this Gene ID
- UniProt
- View information about CD110 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD110 Reagents Request Custom Conjugation| Description | Clone | Applications |
|---|---|---|
| PE anti-human CD110 | S16017E | FC |
| Purified anti-human CD110 | S16017E | FC |
| Brilliant Violet 421™ anti-human CD110 | S16017E | FC |
| PerCP/Cyanine5.5 anti-human CD110 | S16017E | FC |
| PE/Dazzle™ 594 anti-human CD110 | S16017E | FC |
| APC anti-human CD110 | S16017E | FC |
| PE/Cyanine7 anti-human CD110 | S16017E | FC |
| TotalSeq™-A0598 anti-human CD110 | S16017E | PG |
| TotalSeq™-C0598 anti-human CD110 | S16017E | PG |
| TotalSeq™-B0598 anti-human CD110 | S16017E | PG |
| TotalSeq™-D0598 anti-human CD110 Antibody | S16017E | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE anti-human CD110
Resting human platelets were stained with PE anti-human CD11... -
Purified anti-human CD110
Resting human platelets were stained with purified anti-huma... -
Brilliant Violet 421™ anti-human CD110
Resting human platelets were stained with Brilliant Violet 4... -
PerCP/Cyanine5.5 anti-human CD110
Resting human platelets were stained with PerCP/Cyanine5.5 a... -
PE/Dazzle™ 594 anti-human CD110
Resting human platelets were stained with PE/Dazzle™ 594 ant... -
APC anti-human CD110
Resting human platelets were stained with APC anti-human CD1... -
PE/Cyanine7 anti-human CD110
Resting human platelets were stained with PE/Cyanine7 anti-h... -
TotalSeq™-A0598 anti-human CD110
-
TotalSeq™-C0598 anti-human CD110
-
TotalSeq™-B0598 anti-human CD110
-
TotalSeq™-D0598 anti-human CD110 Antibody
Login / Register 


Follow Us