- Clone
- EH12.2H7 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- PD-1, PDCD1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- ACAGCGCCGTATTTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
| Cat # | Size | Price | Quantity Check Availability | Save | ||
|---|---|---|---|---|---|---|
| 329969 | 10 µg | 296€ | ||||
Programmed cell death 1 (PD-1), also known as CD279, is a 55 kD member of the immunoglobulin superfamily. CD279 contains the immunoreceptor tyrosine-based inhibitory motif (ITIM) in the cytoplasmic region and plays a key role in peripheral tolerance and autoimmune disease. CD279 is expressed predominantly on activated T cells, B cells, and myeloid cells. PD-L1 (B7-H1) and PD-L2 (B7-DC) are ligands of CD279 (PD-1) and are members of the B7 gene family. Evidence suggests overlapping functions for these two PD-1 ligands and their constitutive expression on some normal tissues and upregulation on activated antigen-presenting cells. Interaction of CD279 ligands results in inhibition of T cell proliferation and cytokine secretion.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Chimpanzee, Common Marmoset, Cynomolgus, Rhesus, Squirrel Monkey
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: blocking of ligand binding1-3, immunohistochemical staining of paraformaldehyde fixed frozen sections13, and spatial biology (IBEX)15,16. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 329911 and 329912). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 329926) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Dorfman DM, et al. 2006 Am. J. Surg. Pathol. 30:802. (FA)
- Radziewicz H, et al. 2007. J. Virol. 81:2545. (FA)
- Velu V, et al. 2007. J. Virol. 81:5819. (FA)
- Zahn RC, et al. 2008. J. Virol. 82:11577. PubMed
- Chang WS, et al. 2008. J. Immunol. 181:6707. (FC) PubMed
- Nakamoto N, et al. 2009. PLoS Pathog. 5:e1000313. (FA)
- Jones RB, et al. 2009. J. Virol. 83:8722. (FC) PubMed
- Vojnov L, et al. 2010. J. Virol. 84:753. (FC) PubMed
- Radziewicz H, et al. 2010. J. Immunol. 184:2410. (FC) PubMed
- Monteriro P, et al. 2011. J. Immunol. 186:4618. PubMed
- Conrad J, et al. 2011. J. Immunol. 186:6871. PubMed
- Salisch NC, et al. 2010. J. Immunol. 184:476. (Rhesus reactivity)
- Li H and Pauza CD. 2015. Eur. J. Immunol. 45:298. (IHC)
- Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2894607 (BioLegend Cat. No. 329969)
Antigen Details
- Structure
- Immunoglobulin superfamily
- Distribution
-
Transiently expressed on CD4- CD8- thymocytes; upregulated in thymocytes and splenic T and B lymphocytes; expressed on activated myeloid cells
- Ligand/Receptor
- B7-H1 (also known as PD-L1) and B7-DC (PD-L2)
- Cell Type
- B cells, Lymphocytes, T cells, Thymocytes, Tregs
- Biology Area
- Cancer Biomarkers, Immunology, Inhibitory Molecules
- Molecular Family
- CD Molecules, Immune Checkpoint Receptors
- Gene ID
- 5133 View all products for this Gene ID
- UniProt
- View information about CD279 on UniProt.org
Related FAQs
Other Formats
View All CD279 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD279 (PD-1) (Maxpar® Ready)
Human PBMCs were incubated for 3 days in media alone (top) o...
-
GoInVivo™ Purified anti-human CD279 (PD-1)
Anti-human PD-1 inhibits the binding of PD-L1. Immobilized P... -
Brilliant Violet 650™ anti-human CD279 (PD-1)
Human peripheral blood lymphocytes were stained with CD3 FIT...
PHA-stimulated (three days) human peripheral blood lymphocyt...
-
Alexa Fluor® 700 anti-human CD279 (PD-1)
Human peripheral blood lymphocytes were stained with CD3 FIT...
PHA-stimulated (three days) human peripheral blood lymphocyt...
-
APC/Fire™ 750 anti-human CD279 (PD-1)
PHA-stimulated (day 3) human peripheral blood lymphocytes we... -
TotalSeq™-A0088 anti-human CD279 (PD-1)
-
TotalSeq™-B0088 anti-human CD279 (PD-1)
-
TotalSeq™-C0088 anti-human CD279 (PD-1)
-
Brilliant Violet 750™ anti-human CD279 (PD-1)
PHA-stimulated (day 3) human peripheral blood lymphocytes we... -
Brilliant Violet 421™ anti-human CD279 (PD-1)
Human peripheral blood lymphocytes were stained with CD3 FIT...
-
Purified anti-human CD279 (PD-1)
PHA-stimulated (day-3) human peripheral blood lymphocytes we... -
FITC anti-human CD279 (PD-1)
PHA-stimulated (day-3) human peripheral blood lymphocytes we...
Human peripheral blood lymphocytes were stained with CD279 (... -
PE anti-human CD279 (PD-1)
PHA-stimulated (day-3) human peripheral blood lymphocytes we...
Human peripheral blood lymphocytes were stained with CD279 (...
Confocal image of human lymph node sample acquired using the... -
APC anti-human CD279 (PD-1)
PHA-stimulated (day-3) human peripheral blood lymphocytes we...
Human peripheral blood lymphocytes were stained with CD279 (... -
Alexa Fluor® 647 anti-human CD279 (PD-1)
PHA-stimulated (day-3) human peripheral blood lymphocytes we...
Human peripheral blood lymphocytes were stained with CD279 (... -
PerCP/Cyanine5.5 anti-human CD279 (PD-1)
PHA-stimulated (3-day) human peripheral blood lymphocytes we...
Human peripheral blood lymphocytes were stained with CD3 APC... -
APC/Cyanine7 anti-human CD279 (PD-1)
PHA-stimulated (day-3) human peripheral blood lymphocytes st... -
Pacific Blue™ anti-human CD279 (PD-1)
Human peripheral blood lymphocytes were stained with CD279 (...
PHA-stimulated (day-3) human peripheral blood lymphocytes we... -
PE/Cyanine7 anti-human CD279 (PD-1)
PHA-stimulated (day-3) human peripheral blood lymphocytes we...
Human peripheral blood lymphocytes were stained with CD279 (... -
Brilliant Violet 605™ anti-human CD279 (PD-1)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Ultra-LEAF™ Purified anti-human CD279 (PD-1)
-
Brilliant Violet 711™ anti-human CD279 (PD-1)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Brilliant Violet 785™ anti-human CD279 (PD-1)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Brilliant Violet 510™ anti-human CD279 (PD-1)
PHA-stimulated (day-3) human peripheral blood lymphocytes we... -
Biotin anti-human CD279 (PD-1)
PHA-stimulated (3 days) human peripheral blood lymphocytes w... -
PE/Dazzle™ 594 anti-human CD279 (PD-1)
Human peripheral blood lymphocytes were stained with CD3 APC...
PHA-stimulated (day 3) human peripheral blood lymphocytes st...
-
Alexa Fluor® 488 anti-human CD279 (PD-1)
PHA-stimulated (day 3) human peripheral blood lymphocytes we... -
PerCP anti-human CD279 (PD-1)
PHA-stimulated (day 3) human peripheral blood lymphocytes we... -
TotalSeq™-D0088 anti-human CD279 (PD-1)
-
PE/Fire™ 640 anti-human CD279 (PD-1)
PHA stimulated (day 3) human peripheral blood lymphocytes we...
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Cyanine5 anti-human CD279 (PD-1)
PHA-stimulated (3 days) human peripheral blood lymphocytes w... -
PE/Fire™ 744 anti-human CD279 (PD-1)
PHA-stimulated (3-day) human peripheral blood lymphocytes we...
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Red™ 718 anti-human CD279 (PD-1)
PHA-stimulated (3 days) human peripheral blood lymphocytes w... -
Brilliant Violet 570™ anti-human CD279 (PD-1)
PHA-stimulated (3 days) human peripheral blood mononuclear c... -
Spark NIR™ 685 anti-human CD279 (PD-1) Antibody
Human peripheral blood lymphocytes were stained with anti-hu...
PHA-stimulated (3 days) human peripheral blood lymphocytes w... -
Spark PLUS B550™ anti-human CD279 (PD-1) Antibody
PHA-stimulated (3 days) human peripheral blood lymphocytes w...
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark YG™ 581 anti-human CD279 (PD-1) (Flexi-Fluor™)
-
Spark YG™ 593 anti-human CD279 (PD-1) (Flexi-Fluor™) Antibody
-
StarBright UltraViolet 740 anti-human CD279 (PD-1)
Human peripheral blood cells were stained with anti-human CD...
PHA-stimulated (3 days) human peripheral blood mononuclear c... -
PE/Fire™ 700 anti-human CD279 (PD-1) Antibody
PHA-stimulated (3 days) human peripheral blood lymphocytes w...
PHA-stimulated (3 days) human peripheral blood lymphocytes w...
Login / Register 


Follow Us