TotalSeq™-D0176 anti-human CD39 Antibody

Pricing & Availability
Clone
A1 (See other available formats)
Regulatory Status
RUO
Workshop
HCDM listed
Other Names
gp80, E-ATPDase, NTPDase-1, ecto-apyrase, Ec3.6.1.5
Isotype
Mouse IgG1, κ
Barcode Sequence
TTACCTGGTATCCGT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Save
328243 10 µg ¥81,180
Description

Human CD39 is an integral membrane protein with two transmembrane domains. It exists as a homotetramer. Expression of CD39 is found on activated lymphocytes, a subset of T cells and B cells, and dendritic cells with weak staining on monocytes and granulocytes. CD39 and CD73 have been found on regulatory T cells, specifically the effector/memory like T cells. CD39 can hydrolyze both nucleoside triphosphates and diphosphates. CD39 is the dominant ecto nucleotidase of vascular and placental trophoblastic tissues and appears to modulate the functional expression of type 2 purinergic (P2) G protein coupled receptors (GPCRs). CD39 has intrinsic ecto-ATPase activity. Expression of CD39 is induced on T cells and increased on B cells as a late activation antigen.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
PHA activated human lymphocytes
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The A1 antibody binds to the human CD39 cell surface antigen and has been shown to block MHC independent target cell recognition by hapten-specific CTL. Additional reported applications (for the relevant formats) include: in vitro CD39 blockade3,  immunofluorescence4, immunohistochemistry6, and spatial biology (IBEX)7,8. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for blocking assays (contact our custom solutions team).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Aversa GG, et al. 1988. Transplant. P. 20:4952.
  2. Aversa GG, et al. 1989. Transplant. P. 21:34950.
  3. Borsellino G, et al. 2007. Blood. 110:1225. (Block)
  4. Stockl J, et al. 2001. J. Immunol. 167:2724. (IF)
  5. Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
  6. Lyck L, et al. 2008. J. Histochem. Cytochem. 56:201. (IHC)
  7. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  8. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID
AB_2892394 (BioLegend Cat. No. 328243)

Antigen Details

Distribution

Activated lymphocytes, and also on a subset of T cells, regulatory T cells, B cells, and dendritic cells.

Cell Type
B cells, Dendritic cells, Lymphocytes, T cells, Tregs
Biology Area
Immunology
Molecular Family
CD Molecules
Gene ID
953 View all products for this Gene ID
UniProt
View information about CD39 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD39 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD39 (Maxpar® Ready) A1 FC,CyTOF®,IHC-P
PE/Dazzle™ 594 anti-human CD39 A1 FC
APC/Cyanine7 anti-human CD39 A1 FC
Brilliant Violet 711™ anti-human CD39 A1 FC
APC/Fire™ 750 anti-human CD39 A1 FC
Alexa Fluor® 594 anti-human CD39 A1 IHC-P
TotalSeq™-A0176 anti-human CD39 A1 PG
Brilliant Violet 605™ anti-human CD39 A1 FC
TotalSeq™-C0176 anti-human CD39 A1 PG
Brilliant Violet 785™ anti-human CD39 A1 FC
TotalSeq™-B0176 anti-human CD39 A1 PG
Brilliant Violet 510™ anti-human CD39 A1 FC
Brilliant Violet 421™ anti-human CD39 A1 FC,IHC-P
Purified anti-human CD39 A1 FC,IHC-P,Block
Biotin anti-human CD39 A1 FC
FITC anti-human CD39 A1 FC
PE anti-human CD39 A1 FC,SB
APC anti-human CD39 A1 FC
PE/Cyanine7 anti-human CD39 A1 FC
PerCP/Cyanine5.5 anti-human CD39 A1 FC
TotalSeq™-D0176 anti-human CD39 A1 PG
PE/Fire™ 810 anti-human CD39 Antibody A1 FC
PE/Cyanine5 anti-human CD39 A1 FC
PerCP/Fire™ 806 anti-human CD39 A1 FC
Spark NIR™ 685 anti-human CD39 A1 FC
Spark Red™ 718 anti-human CD39 (Flexi-Fluor™) A1 FC
PE/Fire™ 744 anti-human CD39 A1 FC
Alexa Fluor® 700 anti-human CD39 A1 FC
Spark Blue™ 574 anti-human CD39 (Flexi-Fluor™) A1 FC
Spark Blue™ 550 anti-human CD39 (Flexi-Fluor™) A1 FC
Alexa Fluor® 647 anti-human CD39 A1 FC,IHC-P
Spark PLUS UV395™ anti-human CD39 A1 FC
Spark YG™ 581 anti-human CD39 (Flexi-Fluor™) A1 FC
Spark YG™ 593 anti-human CD39 (Flexi-Fluor™) A1 FC
Go To Top Version: 1    Revision Date: 05/25/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account